ID: 959141567

View in Genome Browser
Species Human (GRCh38)
Location 3:102492447-102492469
Sequence GCTGCCTGCCAGTTCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959141564_959141567 0 Left 959141564 3:102492424-102492446 CCTGAGCCAGGGCCATGGGCGGA No data
Right 959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG No data
959141557_959141567 23 Left 959141557 3:102492401-102492423 CCAGCTGGCTTCACCTAGTGGAT 0: 383
1: 1104
2: 562
3: 193
4: 142
Right 959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG No data
959141565_959141567 -6 Left 959141565 3:102492430-102492452 CCAGGGCCATGGGCGGAGCTGCC 0: 5
1: 26
2: 58
3: 124
4: 493
Right 959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG No data
959141560_959141567 10 Left 959141560 3:102492414-102492436 CCTAGTGGATCCTGAGCCAGGGC No data
Right 959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG No data
959141556_959141567 24 Left 959141556 3:102492400-102492422 CCCAGCTGGCTTCACCTAGTGGA 0: 373
1: 1084
2: 559
3: 192
4: 145
Right 959141567 3:102492447-102492469 GCTGCCTGCCAGTTCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959141567 Original CRISPR GCTGCCTGCCAGTTCCACGC TGG Intergenic
No off target data available for this crispr