ID: 959143672

View in Genome Browser
Species Human (GRCh38)
Location 3:102517523-102517545
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959143672_959143674 8 Left 959143672 3:102517523-102517545 CCTTTCTTCTTATTGATTTGCGT No data
Right 959143674 3:102517554-102517576 ATCATTGTTTTCCTTCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959143672 Original CRISPR ACGCAAATCAATAAGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr