ID: 959146298

View in Genome Browser
Species Human (GRCh38)
Location 3:102549618-102549640
Sequence GCACATATCCAGTTCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959146298_959146302 28 Left 959146298 3:102549618-102549640 CCTTCTTTGAACTGGATATGTGC No data
Right 959146302 3:102549669-102549691 GAGACACATTTTATGTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959146298 Original CRISPR GCACATATCCAGTTCAAAGA AGG (reversed) Intergenic
No off target data available for this crispr