ID: 959146563

View in Genome Browser
Species Human (GRCh38)
Location 3:102553155-102553177
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959146560_959146563 6 Left 959146560 3:102553126-102553148 CCTGATTAACTGTGCTATATATA No data
Right 959146563 3:102553155-102553177 ATGTTCCTCTGGAAGAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr