ID: 959153400

View in Genome Browser
Species Human (GRCh38)
Location 3:102635567-102635589
Sequence ATCTCAAGACTGTTGATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959153400_959153402 22 Left 959153400 3:102635567-102635589 CCTGGAATCAACAGTCTTGAGAT No data
Right 959153402 3:102635612-102635634 TCTATGGTCTTTATACCTGAAGG No data
959153400_959153403 27 Left 959153400 3:102635567-102635589 CCTGGAATCAACAGTCTTGAGAT No data
Right 959153403 3:102635617-102635639 GGTCTTTATACCTGAAGGACAGG No data
959153400_959153401 6 Left 959153400 3:102635567-102635589 CCTGGAATCAACAGTCTTGAGAT No data
Right 959153401 3:102635596-102635618 TGCAAGTTAATAAATGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959153400 Original CRISPR ATCTCAAGACTGTTGATTCC AGG (reversed) Intergenic
No off target data available for this crispr