ID: 959159201

View in Genome Browser
Species Human (GRCh38)
Location 3:102703546-102703568
Sequence CCTGCAGAGACTGCCCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959159201_959159208 19 Left 959159201 3:102703546-102703568 CCTGCTAGGGCAGTCTCTGCAGG No data
Right 959159208 3:102703588-102703610 AAACGGCTCCTGGAGTTTGGTGG No data
959159201_959159207 16 Left 959159201 3:102703546-102703568 CCTGCTAGGGCAGTCTCTGCAGG No data
Right 959159207 3:102703585-102703607 TGGAAACGGCTCCTGGAGTTTGG No data
959159201_959159206 9 Left 959159201 3:102703546-102703568 CCTGCTAGGGCAGTCTCTGCAGG No data
Right 959159206 3:102703578-102703600 GCTGTGTTGGAAACGGCTCCTGG No data
959159201_959159205 2 Left 959159201 3:102703546-102703568 CCTGCTAGGGCAGTCTCTGCAGG No data
Right 959159205 3:102703571-102703593 AGGCTGTGCTGTGTTGGAAACGG No data
959159201_959159204 -4 Left 959159201 3:102703546-102703568 CCTGCTAGGGCAGTCTCTGCAGG No data
Right 959159204 3:102703565-102703587 CAGGAAAGGCTGTGCTGTGTTGG No data
959159201_959159209 26 Left 959159201 3:102703546-102703568 CCTGCTAGGGCAGTCTCTGCAGG No data
Right 959159209 3:102703595-102703617 TCCTGGAGTTTGGTGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959159201 Original CRISPR CCTGCAGAGACTGCCCTAGC AGG (reversed) Intergenic
No off target data available for this crispr