ID: 959161776

View in Genome Browser
Species Human (GRCh38)
Location 3:102732820-102732842
Sequence CGGCAAACAACAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959161766_959161776 24 Left 959161766 3:102732773-102732795 CCCTGCTGGATCCGGAGGGATGG 0: 20
1: 71
2: 130
3: 138
4: 219
Right 959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG No data
959161768_959161776 23 Left 959161768 3:102732774-102732796 CCTGCTGGATCCGGAGGGATGGA 0: 12
1: 72
2: 118
3: 157
4: 197
Right 959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG No data
959161770_959161776 13 Left 959161770 3:102732784-102732806 CCGGAGGGATGGAAGTCAGTGGC No data
Right 959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959161776 Original CRISPR CGGCAAACAACAGTGGTGGA TGG Intergenic
No off target data available for this crispr