ID: 959162355

View in Genome Browser
Species Human (GRCh38)
Location 3:102737581-102737603
Sequence CTGGAGGCCTTATGTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959162346_959162355 10 Left 959162346 3:102737548-102737570 CCTGGCTCAGGTTGGGGGCTGGG No data
Right 959162355 3:102737581-102737603 CTGGAGGCCTTATGTGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959162355 Original CRISPR CTGGAGGCCTTATGTGGAAC TGG Intergenic
No off target data available for this crispr