ID: 959167165

View in Genome Browser
Species Human (GRCh38)
Location 3:102794774-102794796
Sequence AGCTGCTTTTAAAAGTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959167161_959167165 -10 Left 959167161 3:102794761-102794783 CCCTCCAACAAAAAGCTGCTTTT No data
Right 959167165 3:102794774-102794796 AGCTGCTTTTAAAAGTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959167165 Original CRISPR AGCTGCTTTTAAAAGTCTAA GGG Intergenic
No off target data available for this crispr