ID: 959174800

View in Genome Browser
Species Human (GRCh38)
Location 3:102893627-102893649
Sequence CATAGAAAGACAAATACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959174797_959174800 12 Left 959174797 3:102893592-102893614 CCTGGAGAAACTTATGTTAAGAG No data
Right 959174800 3:102893627-102893649 CATAGAAAGACAAATACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959174800 Original CRISPR CATAGAAAGACAAATACTGC AGG Intergenic
No off target data available for this crispr