ID: 959180001

View in Genome Browser
Species Human (GRCh38)
Location 3:102966882-102966904
Sequence ACAAATATACAAAGATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959180001_959180004 12 Left 959180001 3:102966882-102966904 CCTTCCAATCTTTGTATATTTGT No data
Right 959180004 3:102966917-102966939 ATGTATATTTAAATATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959180001 Original CRISPR ACAAATATACAAAGATTGGA AGG (reversed) Intergenic
No off target data available for this crispr