ID: 959185162

View in Genome Browser
Species Human (GRCh38)
Location 3:103037637-103037659
Sequence AATCAGTTATAGGTGACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959185162_959185167 -5 Left 959185162 3:103037637-103037659 CCCTGAGTCACCTATAACTGATT No data
Right 959185167 3:103037655-103037677 TGATTTAAATTATGGCATTTGGG No data
959185162_959185166 -6 Left 959185162 3:103037637-103037659 CCCTGAGTCACCTATAACTGATT No data
Right 959185166 3:103037654-103037676 CTGATTTAAATTATGGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959185162 Original CRISPR AATCAGTTATAGGTGACTCA GGG (reversed) Intergenic
No off target data available for this crispr