ID: 959185162 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:103037637-103037659 |
| Sequence | AATCAGTTATAGGTGACTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959185162_959185167 | -5 | Left | 959185162 | 3:103037637-103037659 | CCCTGAGTCACCTATAACTGATT | No data | ||
| Right | 959185167 | 3:103037655-103037677 | TGATTTAAATTATGGCATTTGGG | No data | ||||
| 959185162_959185166 | -6 | Left | 959185162 | 3:103037637-103037659 | CCCTGAGTCACCTATAACTGATT | No data | ||
| Right | 959185166 | 3:103037654-103037676 | CTGATTTAAATTATGGCATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959185162 | Original CRISPR | AATCAGTTATAGGTGACTCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||