ID: 959186125

View in Genome Browser
Species Human (GRCh38)
Location 3:103050055-103050077
Sequence AGATTTAAAGAGGTTGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959186122_959186125 0 Left 959186122 3:103050032-103050054 CCCTCTATTAGTTGGGAGTAGAT No data
Right 959186125 3:103050055-103050077 AGATTTAAAGAGGTTGTAAAAGG No data
959186123_959186125 -1 Left 959186123 3:103050033-103050055 CCTCTATTAGTTGGGAGTAGATA No data
Right 959186125 3:103050055-103050077 AGATTTAAAGAGGTTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959186125 Original CRISPR AGATTTAAAGAGGTTGTAAA AGG Intergenic
No off target data available for this crispr