ID: 959186546

View in Genome Browser
Species Human (GRCh38)
Location 3:103053509-103053531
Sequence CTGTGATAAGTGTGAATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959186543_959186546 10 Left 959186543 3:103053476-103053498 CCTGCTTTCAGTCTGGGGTGAGC No data
Right 959186546 3:103053509-103053531 CTGTGATAAGTGTGAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959186546 Original CRISPR CTGTGATAAGTGTGAATCCC AGG Intergenic
No off target data available for this crispr