ID: 959187555

View in Genome Browser
Species Human (GRCh38)
Location 3:103065445-103065467
Sequence TAGCCGACTCCCCTTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959187550_959187555 30 Left 959187550 3:103065392-103065414 CCACTTATGATCAGTCTTACATA No data
Right 959187555 3:103065445-103065467 TAGCCGACTCCCCTTGGTATTGG No data
959187552_959187555 -8 Left 959187552 3:103065430-103065452 CCTGATCCTCTTCACTAGCCGAC No data
Right 959187555 3:103065445-103065467 TAGCCGACTCCCCTTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959187555 Original CRISPR TAGCCGACTCCCCTTGGTAT TGG Intergenic
No off target data available for this crispr