ID: 959191072

View in Genome Browser
Species Human (GRCh38)
Location 3:103112399-103112421
Sequence AGGGAGACTGCAGTGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959191065_959191072 14 Left 959191065 3:103112362-103112384 CCATGTGGTGCAGAGAGAAAATC No data
Right 959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG No data
959191064_959191072 25 Left 959191064 3:103112351-103112373 CCTGGCAGTGGCCATGTGGTGCA No data
Right 959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959191072 Original CRISPR AGGGAGACTGCAGTGACTGG GGG Intergenic
No off target data available for this crispr