ID: 959191223

View in Genome Browser
Species Human (GRCh38)
Location 3:103113615-103113637
Sequence CTCTGGACACACTTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959191216_959191223 -4 Left 959191216 3:103113596-103113618 CCTGGCTCCCAGTTAGTATCTCT No data
Right 959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG No data
959191215_959191223 -3 Left 959191215 3:103113595-103113617 CCCTGGCTCCCAGTTAGTATCTC No data
Right 959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959191223 Original CRISPR CTCTGGACACACTTGGGGCC TGG Intergenic
No off target data available for this crispr