ID: 959193392

View in Genome Browser
Species Human (GRCh38)
Location 3:103144576-103144598
Sequence TAAGCTGGCCAATTTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959193392_959193400 28 Left 959193392 3:103144576-103144598 CCTTGATCAAATTGGCCAGCTTA No data
Right 959193400 3:103144627-103144649 CTTTGGATGGTATACTCATTTGG No data
959193392_959193394 11 Left 959193392 3:103144576-103144598 CCTTGATCAAATTGGCCAGCTTA No data
Right 959193394 3:103144610-103144632 CTTCATATCCCCCACAGCTTTGG No data
959193392_959193395 15 Left 959193392 3:103144576-103144598 CCTTGATCAAATTGGCCAGCTTA No data
Right 959193395 3:103144614-103144636 ATATCCCCCACAGCTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959193392 Original CRISPR TAAGCTGGCCAATTTGATCA AGG (reversed) Intergenic
No off target data available for this crispr