ID: 959194207

View in Genome Browser
Species Human (GRCh38)
Location 3:103157439-103157461
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959194205_959194207 -2 Left 959194205 3:103157418-103157440 CCTGACTATAAGAAAGAGAGTAA No data
Right 959194207 3:103157439-103157461 AAATCCATAGAGTGTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr