ID: 959198788

View in Genome Browser
Species Human (GRCh38)
Location 3:103220428-103220450
Sequence CTGCAAAAACTGATGAAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959198784_959198788 16 Left 959198784 3:103220389-103220411 CCCATATGAATAGCCTCCACTAG No data
Right 959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG No data
959198785_959198788 15 Left 959198785 3:103220390-103220412 CCATATGAATAGCCTCCACTAGC No data
Right 959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG No data
959198786_959198788 3 Left 959198786 3:103220402-103220424 CCTCCACTAGCTGACATAGATTC No data
Right 959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG No data
959198787_959198788 0 Left 959198787 3:103220405-103220427 CCACTAGCTGACATAGATTCAGA No data
Right 959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959198788 Original CRISPR CTGCAAAAACTGATGAAGTT CGG Intergenic
No off target data available for this crispr