ID: 959201697

View in Genome Browser
Species Human (GRCh38)
Location 3:103255064-103255086
Sequence CGGGGTGGCTGCGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959201677_959201697 27 Left 959201677 3:103255014-103255036 CCCTCCCGGACGGGGCGGCTGCC 0: 123
1: 4519
2: 3335
3: 1279
4: 508
Right 959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG No data
959201678_959201697 26 Left 959201678 3:103255015-103255037 CCTCCCGGACGGGGCGGCTGCCG 0: 149
1: 818
2: 6348
3: 5320
4: 3711
Right 959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG No data
959201676_959201697 30 Left 959201676 3:103255011-103255033 CCTCCCTCCCGGACGGGGCGGCT 0: 3867
1: 3677
2: 1812
3: 883
4: 514
Right 959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG No data
959201682_959201697 22 Left 959201682 3:103255019-103255041 CCGGACGGGGCGGCTGCCGGGCG 0: 283
1: 1228
2: 1413
3: 2093
4: 8523
Right 959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG No data
959201684_959201697 6 Left 959201684 3:103255035-103255057 CCGGGCGGAGACGCTCCTCACTT 0: 1099
1: 3760
2: 4462
3: 8074
4: 7819
Right 959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG No data
959201681_959201697 23 Left 959201681 3:103255018-103255040 CCCGGACGGGGCGGCTGCCGGGC 0: 180
1: 973
2: 1258
3: 7754
4: 8143
Right 959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG No data
959201689_959201697 -9 Left 959201689 3:103255050-103255072 CCTCACTTCCCAGACGGGGTGGC 0: 1882
1: 2591
2: 6222
3: 11614
4: 5578
Right 959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959201697 Original CRISPR CGGGGTGGCTGCGGGGTGGA GGG Intergenic
No off target data available for this crispr