ID: 959210184

View in Genome Browser
Species Human (GRCh38)
Location 3:103368988-103369010
Sequence CTGAGAGAAGTGAAGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959210184_959210189 1 Left 959210184 3:103368988-103369010 CCCACCTTCTTCACTTCTCTCAG No data
Right 959210189 3:103369012-103369034 CTTTATCGAACTGAACAGTTGGG No data
959210184_959210190 2 Left 959210184 3:103368988-103369010 CCCACCTTCTTCACTTCTCTCAG No data
Right 959210190 3:103369013-103369035 TTTATCGAACTGAACAGTTGGGG No data
959210184_959210191 23 Left 959210184 3:103368988-103369010 CCCACCTTCTTCACTTCTCTCAG No data
Right 959210191 3:103369034-103369056 GGTCTTGCTCAATTAGCCTTTGG No data
959210184_959210188 0 Left 959210184 3:103368988-103369010 CCCACCTTCTTCACTTCTCTCAG No data
Right 959210188 3:103369011-103369033 CCTTTATCGAACTGAACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959210184 Original CRISPR CTGAGAGAAGTGAAGAAGGT GGG (reversed) Intergenic
No off target data available for this crispr