ID: 959211120

View in Genome Browser
Species Human (GRCh38)
Location 3:103382234-103382256
Sequence TTTTATCCCCAGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959211120_959211123 5 Left 959211120 3:103382234-103382256 CCATCCACCTTCTGGGGATAAAA No data
Right 959211123 3:103382262-103382284 GAGCCAGTCCTTGTTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959211120 Original CRISPR TTTTATCCCCAGAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr