ID: 959213799

View in Genome Browser
Species Human (GRCh38)
Location 3:103423864-103423886
Sequence GCAACATCCTGGGCTAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959213792_959213799 29 Left 959213792 3:103423812-103423834 CCTCTTTTTTCACTTGTAGTTTG No data
Right 959213799 3:103423864-103423886 GCAACATCCTGGGCTAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959213799 Original CRISPR GCAACATCCTGGGCTAAGAG GGG Intergenic
No off target data available for this crispr