ID: 959216288

View in Genome Browser
Species Human (GRCh38)
Location 3:103454647-103454669
Sequence GGAAGCACAAAGTGACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959216288_959216295 21 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216295 3:103454691-103454713 AAAAATGTAGTTTATATACTAGG No data
959216288_959216300 30 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data
959216288_959216297 23 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216297 3:103454693-103454715 AAATGTAGTTTATATACTAGGGG No data
959216288_959216296 22 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216296 3:103454692-103454714 AAAATGTAGTTTATATACTAGGG No data
959216288_959216299 25 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216299 3:103454695-103454717 ATGTAGTTTATATACTAGGGGGG No data
959216288_959216298 24 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216298 3:103454694-103454716 AATGTAGTTTATATACTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959216288 Original CRISPR GGAAGCACAAAGTGACTGCA AGG (reversed) Intergenic
No off target data available for this crispr