ID: 959216292

View in Genome Browser
Species Human (GRCh38)
Location 3:103454674-103454696
Sequence ATTTTTTCTCTAGGGTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959216292_959216303 15 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216303 3:103454712-103454734 GGGGGGTTAGGAGTATGATGGGG No data
959216292_959216299 -2 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216299 3:103454695-103454717 ATGTAGTTTATATACTAGGGGGG No data
959216292_959216298 -3 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216298 3:103454694-103454716 AATGTAGTTTATATACTAGGGGG No data
959216292_959216295 -6 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216295 3:103454691-103454713 AAAAATGTAGTTTATATACTAGG No data
959216292_959216296 -5 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216296 3:103454692-103454714 AAAATGTAGTTTATATACTAGGG No data
959216292_959216302 14 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216302 3:103454711-103454733 AGGGGGGTTAGGAGTATGATGGG No data
959216292_959216297 -4 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216297 3:103454693-103454715 AAATGTAGTTTATATACTAGGGG No data
959216292_959216301 13 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216301 3:103454710-103454732 TAGGGGGGTTAGGAGTATGATGG No data
959216292_959216300 3 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959216292 Original CRISPR ATTTTTTCTCTAGGGTCCAT TGG (reversed) Intergenic
No off target data available for this crispr