ID: 959216295

View in Genome Browser
Species Human (GRCh38)
Location 3:103454691-103454713
Sequence AAAAATGTAGTTTATATACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959216291_959216295 -1 Left 959216291 3:103454669-103454691 CCATGCCAATGGACCCTAGAGAA No data
Right 959216295 3:103454691-103454713 AAAAATGTAGTTTATATACTAGG No data
959216288_959216295 21 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216295 3:103454691-103454713 AAAAATGTAGTTTATATACTAGG No data
959216292_959216295 -6 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216295 3:103454691-103454713 AAAAATGTAGTTTATATACTAGG No data
959216290_959216295 0 Left 959216290 3:103454668-103454690 CCCATGCCAATGGACCCTAGAGA No data
Right 959216295 3:103454691-103454713 AAAAATGTAGTTTATATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959216295 Original CRISPR AAAAATGTAGTTTATATACT AGG Intergenic
No off target data available for this crispr