ID: 959216298

View in Genome Browser
Species Human (GRCh38)
Location 3:103454694-103454716
Sequence AATGTAGTTTATATACTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959216288_959216298 24 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216298 3:103454694-103454716 AATGTAGTTTATATACTAGGGGG No data
959216291_959216298 2 Left 959216291 3:103454669-103454691 CCATGCCAATGGACCCTAGAGAA No data
Right 959216298 3:103454694-103454716 AATGTAGTTTATATACTAGGGGG No data
959216292_959216298 -3 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216298 3:103454694-103454716 AATGTAGTTTATATACTAGGGGG No data
959216290_959216298 3 Left 959216290 3:103454668-103454690 CCCATGCCAATGGACCCTAGAGA No data
Right 959216298 3:103454694-103454716 AATGTAGTTTATATACTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959216298 Original CRISPR AATGTAGTTTATATACTAGG GGG Intergenic
No off target data available for this crispr