ID: 959216300

View in Genome Browser
Species Human (GRCh38)
Location 3:103454700-103454722
Sequence GTTTATATACTAGGGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959216292_959216300 3 Left 959216292 3:103454674-103454696 CCAATGGACCCTAGAGAAAAAAT No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data
959216293_959216300 -5 Left 959216293 3:103454682-103454704 CCCTAGAGAAAAAATGTAGTTTA No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data
959216288_959216300 30 Left 959216288 3:103454647-103454669 CCTTGCAGTCACTTTGTGCTTCC No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data
959216290_959216300 9 Left 959216290 3:103454668-103454690 CCCATGCCAATGGACCCTAGAGA No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data
959216291_959216300 8 Left 959216291 3:103454669-103454691 CCATGCCAATGGACCCTAGAGAA No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data
959216294_959216300 -6 Left 959216294 3:103454683-103454705 CCTAGAGAAAAAATGTAGTTTAT No data
Right 959216300 3:103454700-103454722 GTTTATATACTAGGGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959216300 Original CRISPR GTTTATATACTAGGGGGGTT AGG Intergenic
No off target data available for this crispr