ID: 959226778

View in Genome Browser
Species Human (GRCh38)
Location 3:103597268-103597290
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959226778_959226781 11 Left 959226778 3:103597268-103597290 CCAGTAACAGGCCAAAAGCTGTC No data
Right 959226781 3:103597302-103597324 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959226778 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr