ID: 959226825

View in Genome Browser
Species Human (GRCh38)
Location 3:103597604-103597626
Sequence AATGCCTAGTGGACCTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959226825_959226832 2 Left 959226825 3:103597604-103597626 CCCAAATAGGTCCACTAGGCATT No data
Right 959226832 3:103597629-103597651 GCCTTTTTCTTGGTTGCAGGGGG No data
959226825_959226828 -8 Left 959226825 3:103597604-103597626 CCCAAATAGGTCCACTAGGCATT No data
Right 959226828 3:103597619-103597641 TAGGCATTGTGCCTTTTTCTTGG 0: 9
1: 108
2: 136
3: 164
4: 336
959226825_959226829 -1 Left 959226825 3:103597604-103597626 CCCAAATAGGTCCACTAGGCATT No data
Right 959226829 3:103597626-103597648 TGTGCCTTTTTCTTGGTTGCAGG No data
959226825_959226831 1 Left 959226825 3:103597604-103597626 CCCAAATAGGTCCACTAGGCATT No data
Right 959226831 3:103597628-103597650 TGCCTTTTTCTTGGTTGCAGGGG No data
959226825_959226830 0 Left 959226825 3:103597604-103597626 CCCAAATAGGTCCACTAGGCATT No data
Right 959226830 3:103597627-103597649 GTGCCTTTTTCTTGGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959226825 Original CRISPR AATGCCTAGTGGACCTATTT GGG (reversed) Intergenic
No off target data available for this crispr