ID: 959228229

View in Genome Browser
Species Human (GRCh38)
Location 3:103614217-103614239
Sequence ATGTGTGTGCATCTTTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959228229_959228233 29 Left 959228229 3:103614217-103614239 CCATGTAAAAGATGCACACACAT No data
Right 959228233 3:103614269-103614291 CATTCTTGCATATCACAACTGGG No data
959228229_959228232 28 Left 959228229 3:103614217-103614239 CCATGTAAAAGATGCACACACAT No data
Right 959228232 3:103614268-103614290 TCATTCTTGCATATCACAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959228229 Original CRISPR ATGTGTGTGCATCTTTTACA TGG (reversed) Intergenic
No off target data available for this crispr