ID: 959232356

View in Genome Browser
Species Human (GRCh38)
Location 3:103670931-103670953
Sequence GAGTGTAAATTCATTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959232356_959232359 14 Left 959232356 3:103670931-103670953 CCTGCCTCAATGAATTTACACTC No data
Right 959232359 3:103670968-103670990 ATGATGTGAAAGCAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959232356 Original CRISPR GAGTGTAAATTCATTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr