ID: 959234013

View in Genome Browser
Species Human (GRCh38)
Location 3:103694327-103694349
Sequence CACCTACCTGAATAGCTTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959234013_959234014 7 Left 959234013 3:103694327-103694349 CCGGAAAGCTATTCAGGTAGGTG No data
Right 959234014 3:103694357-103694379 CTCAGTTTGAACTATTGAGCAGG No data
959234013_959234016 20 Left 959234013 3:103694327-103694349 CCGGAAAGCTATTCAGGTAGGTG No data
Right 959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG No data
959234013_959234015 16 Left 959234013 3:103694327-103694349 CCGGAAAGCTATTCAGGTAGGTG No data
Right 959234015 3:103694366-103694388 AACTATTGAGCAGGAGAATTAGG No data
959234013_959234018 25 Left 959234013 3:103694327-103694349 CCGGAAAGCTATTCAGGTAGGTG No data
Right 959234018 3:103694375-103694397 GCAGGAGAATTAGGAAGGTAGGG No data
959234013_959234017 24 Left 959234013 3:103694327-103694349 CCGGAAAGCTATTCAGGTAGGTG No data
Right 959234017 3:103694374-103694396 AGCAGGAGAATTAGGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959234013 Original CRISPR CACCTACCTGAATAGCTTTC CGG (reversed) Intergenic
No off target data available for this crispr