ID: 959234014

View in Genome Browser
Species Human (GRCh38)
Location 3:103694357-103694379
Sequence CTCAGTTTGAACTATTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959234013_959234014 7 Left 959234013 3:103694327-103694349 CCGGAAAGCTATTCAGGTAGGTG No data
Right 959234014 3:103694357-103694379 CTCAGTTTGAACTATTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959234014 Original CRISPR CTCAGTTTGAACTATTGAGC AGG Intergenic
No off target data available for this crispr