ID: 959239220

View in Genome Browser
Species Human (GRCh38)
Location 3:103767127-103767149
Sequence GACTCATCTTAGACCCTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959239220_959239222 -2 Left 959239220 3:103767127-103767149 CCGCACAGGGTCTAAGATGAGTC No data
Right 959239222 3:103767148-103767170 TCTTTCAGGTCATTTTTGAATGG No data
959239220_959239223 18 Left 959239220 3:103767127-103767149 CCGCACAGGGTCTAAGATGAGTC No data
Right 959239223 3:103767168-103767190 TGGTGCAATTACATCATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959239220 Original CRISPR GACTCATCTTAGACCCTGTG CGG (reversed) Intergenic
No off target data available for this crispr