ID: 959243770

View in Genome Browser
Species Human (GRCh38)
Location 3:103835806-103835828
Sequence CTTTGCTTGAACAAATGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959243770_959243772 25 Left 959243770 3:103835806-103835828 CCAGGACATTTGTTCAAGCAAAG No data
Right 959243772 3:103835854-103835876 ATAAGCAAACAAAGCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959243770 Original CRISPR CTTTGCTTGAACAAATGTCC TGG (reversed) Intergenic
No off target data available for this crispr