ID: 959245569

View in Genome Browser
Species Human (GRCh38)
Location 3:103863210-103863232
Sequence CACAGGGATGGAGCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959245562_959245569 19 Left 959245562 3:103863168-103863190 CCAAACCATGAGAGCAGCTATGA No data
Right 959245569 3:103863210-103863232 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322
959245565_959245569 14 Left 959245565 3:103863173-103863195 CCATGAGAGCAGCTATGAGGGCT No data
Right 959245569 3:103863210-103863232 CACAGGGATGGAGCTGCCCAAGG 0: 32
1: 253
2: 494
3: 817
4: 1322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959245569 Original CRISPR CACAGGGATGGAGCTGCCCA AGG Intergenic
Too many off-targets to display for this crispr