ID: 959246034 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:103869150-103869172 |
| Sequence | TATCCTCATTCACAGATTTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959246034_959246035 | 8 | Left | 959246034 | 3:103869150-103869172 | CCACAAATCTGTGAATGAGGATA | No data | ||
| Right | 959246035 | 3:103869181-103869203 | CACTTTACTGCTTCTTACTAAGG | No data | ||||
| 959246034_959246036 | 14 | Left | 959246034 | 3:103869150-103869172 | CCACAAATCTGTGAATGAGGATA | No data | ||
| Right | 959246036 | 3:103869187-103869209 | ACTGCTTCTTACTAAGGCATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959246034 | Original CRISPR | TATCCTCATTCACAGATTTG TGG (reversed) | Intergenic | ||