ID: 959246034

View in Genome Browser
Species Human (GRCh38)
Location 3:103869150-103869172
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959246034_959246035 8 Left 959246034 3:103869150-103869172 CCACAAATCTGTGAATGAGGATA No data
Right 959246035 3:103869181-103869203 CACTTTACTGCTTCTTACTAAGG No data
959246034_959246036 14 Left 959246034 3:103869150-103869172 CCACAAATCTGTGAATGAGGATA No data
Right 959246036 3:103869187-103869209 ACTGCTTCTTACTAAGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959246034 Original CRISPR TATCCTCATTCACAGATTTG TGG (reversed) Intergenic