ID: 959246035

View in Genome Browser
Species Human (GRCh38)
Location 3:103869181-103869203
Sequence CACTTTACTGCTTCTTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959246034_959246035 8 Left 959246034 3:103869150-103869172 CCACAAATCTGTGAATGAGGATA No data
Right 959246035 3:103869181-103869203 CACTTTACTGCTTCTTACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959246035 Original CRISPR CACTTTACTGCTTCTTACTA AGG Intergenic
No off target data available for this crispr