ID: 959247860

View in Genome Browser
Species Human (GRCh38)
Location 3:103898246-103898268
Sequence CTTGTCAATGCCAAATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959247860_959247862 13 Left 959247860 3:103898246-103898268 CCCATCAATTTGGCATTGACAAG No data
Right 959247862 3:103898282-103898304 ATTTAAAAGAGTCCTGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959247860 Original CRISPR CTTGTCAATGCCAAATTGAT GGG (reversed) Intergenic
No off target data available for this crispr