ID: 959254900

View in Genome Browser
Species Human (GRCh38)
Location 3:103996770-103996792
Sequence TGAGCTCTGATGAAGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959254899_959254900 1 Left 959254899 3:103996746-103996768 CCTTCAGTTTCTTAATTGTAAAA No data
Right 959254900 3:103996770-103996792 TGAGCTCTGATGAAGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959254900 Original CRISPR TGAGCTCTGATGAAGCCAGC TGG Intergenic
No off target data available for this crispr