ID: 959260346

View in Genome Browser
Species Human (GRCh38)
Location 3:104071563-104071585
Sequence TTTGTATAATTTTAAAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959260346_959260350 21 Left 959260346 3:104071563-104071585 CCTAAATTTTAAAATTATACAAA No data
Right 959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG No data
959260346_959260351 29 Left 959260346 3:104071563-104071585 CCTAAATTTTAAAATTATACAAA No data
Right 959260351 3:104071615-104071637 TGATAAAAATCCAGGCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959260346 Original CRISPR TTTGTATAATTTTAAAATTT AGG (reversed) Intergenic
No off target data available for this crispr