ID: 959260350

View in Genome Browser
Species Human (GRCh38)
Location 3:104071607-104071629
Sequence CAAAATGCTGATAAAAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959260349_959260350 -10 Left 959260349 3:104071594-104071616 CCAAGAAATCAATCAAAATGCTG No data
Right 959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG No data
959260346_959260350 21 Left 959260346 3:104071563-104071585 CCTAAATTTTAAAATTATACAAA No data
Right 959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959260350 Original CRISPR CAAAATGCTGATAAAAATCC AGG Intergenic
No off target data available for this crispr