ID: 959260351

View in Genome Browser
Species Human (GRCh38)
Location 3:104071615-104071637
Sequence TGATAAAAATCCAGGCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959260346_959260351 29 Left 959260346 3:104071563-104071585 CCTAAATTTTAAAATTATACAAA No data
Right 959260351 3:104071615-104071637 TGATAAAAATCCAGGCAGATAGG No data
959260349_959260351 -2 Left 959260349 3:104071594-104071616 CCAAGAAATCAATCAAAATGCTG No data
Right 959260351 3:104071615-104071637 TGATAAAAATCCAGGCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959260351 Original CRISPR TGATAAAAATCCAGGCAGAT AGG Intergenic
No off target data available for this crispr