ID: 959260352

View in Genome Browser
Species Human (GRCh38)
Location 3:104071619-104071641
Sequence AAAAATCCAGGCAGATAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959260349_959260352 2 Left 959260349 3:104071594-104071616 CCAAGAAATCAATCAAAATGCTG No data
Right 959260352 3:104071619-104071641 AAAAATCCAGGCAGATAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959260352 Original CRISPR AAAAATCCAGGCAGATAGGA TGG Intergenic
No off target data available for this crispr