ID: 959275398

View in Genome Browser
Species Human (GRCh38)
Location 3:104271135-104271157
Sequence CACATGTAGGGCTTACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959275398_959275403 21 Left 959275398 3:104271135-104271157 CCTGCTTGTAAGCCCTACATGTG No data
Right 959275403 3:104271179-104271201 GAACAAGTTCATCCCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959275398 Original CRISPR CACATGTAGGGCTTACAAGC AGG (reversed) Intergenic