ID: 959275766

View in Genome Browser
Species Human (GRCh38)
Location 3:104276149-104276171
Sequence TCATTTACTACTTTCTTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959275765_959275766 24 Left 959275765 3:104276102-104276124 CCAACACAAACACAAACAGACAG No data
Right 959275766 3:104276149-104276171 TCATTTACTACTTTCTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959275766 Original CRISPR TCATTTACTACTTTCTTAAT TGG Intergenic