ID: 959275767

View in Genome Browser
Species Human (GRCh38)
Location 3:104276155-104276177
Sequence ACTACTTTCTTAATTGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959275765_959275767 30 Left 959275765 3:104276102-104276124 CCAACACAAACACAAACAGACAG No data
Right 959275767 3:104276155-104276177 ACTACTTTCTTAATTGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959275767 Original CRISPR ACTACTTTCTTAATTGGTAC TGG Intergenic
No off target data available for this crispr