ID: 959275767 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:104276155-104276177 |
| Sequence | ACTACTTTCTTAATTGGTAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959275765_959275767 | 30 | Left | 959275765 | 3:104276102-104276124 | CCAACACAAACACAAACAGACAG | No data | ||
| Right | 959275767 | 3:104276155-104276177 | ACTACTTTCTTAATTGGTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959275767 | Original CRISPR | ACTACTTTCTTAATTGGTAC TGG | Intergenic | ||