ID: 959279148

View in Genome Browser
Species Human (GRCh38)
Location 3:104316238-104316260
Sequence GCTGGTGGGTGAGAGAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959279148_959279160 18 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279160 3:104316279-104316301 CAGCTCTGGGCAGTGAGGGAGGG No data
959279148_959279156 5 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279156 3:104316266-104316288 TTGCTGTGGAGTGCAGCTCTGGG No data
959279148_959279155 4 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG No data
959279148_959279157 13 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279157 3:104316274-104316296 GAGTGCAGCTCTGGGCAGTGAGG No data
959279148_959279152 -9 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279152 3:104316252-104316274 CCCACCAGCAGCAGTTGCTGTGG No data
959279148_959279158 14 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279158 3:104316275-104316297 AGTGCAGCTCTGGGCAGTGAGGG No data
959279148_959279159 17 Left 959279148 3:104316238-104316260 CCAACCCTCTCTCACCCACCAGC No data
Right 959279159 3:104316278-104316300 GCAGCTCTGGGCAGTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959279148 Original CRISPR GCTGGTGGGTGAGAGAGGGT TGG (reversed) Intergenic
No off target data available for this crispr